Microbial 'omics


Brought to you by

linkmers-txt [artifact]

Table of Contents

TXT

A TXT-type anvi’o artifact. This artifact is typically provided by the user for anvi’o to import into its databases, process, and/or use.

🔙 To the main page of anvi’o programs and artifacts.

Provided by

anvi-report-linkmers anvi-script-transpose-matrix

Required or used by

anvi-oligotype-linkmers anvi-script-transpose-matrix

Description

This is a tab-delimited table where each row represents a a short read that mapped to a specific position in a reference contig. This is the output of anvi-report-linkmers, where those reference positions are given by the user.

For instance, if anvi-report-linkmers was run on three samples (SAMPLE-01.bam, SAMPLE-02.bam, and SAMPLE-03.bam) with this contigs-and-positions file,

contig_1720 7111,7115,7120

Then the output would be the following:

entry_id sample_id request_id contig_name pos_in_contig pos_in_read base read_unique_id read_X reverse sequence
000000001 SAMPLE-01 001 contig_1720 7111 160 G bc3aa6b95ce110067 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000002 SAMPLE-01 001 contig_1720 7111 160 G 156295ff5928fc055 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTT
000000003 SAMPLE-01 001 contig_1720 7111 141 G 7a8947678111bb905 read-2 True TTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACA
000000004 SAMPLE-01 001 contig_1720 7111 135 A 2a3de408930252949 read-2 False TGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTAGGAGTGTTT
000000005 SAMPLE-01 001 contig_1720 7111 130 G 5f995d129fdabe64f read-2 True ATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATT
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000033 SAMPLE-01 001 contig_1720 7115 164 A bc3aa6b95ce110067 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000034 SAMPLE-01 001 contig_1720 7115 164 A 156295ff5928fc055 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTT
000000035 SAMPLE-01 001 contig_1720 7115 145 A 7a8947678111bb905 read-2 True TTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACA
000000036 SAMPLE-01 001 contig_1720 7115 139 G 2a3de408930252949 read-2 False TGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTAGGAGTGTTT
000000064 SAMPLE-01 001 contig_1720 7115 16 A 28a3a440fda5142b9 read-2 True AGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACCGGTAATGTTAGGAATTATCTATTTAGCTAGTAAGGGTGTGGTTAAA
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000065 SAMPLE-01 001 contig_1720 7120 169 T bc3aa6b95ce110067 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000066 SAMPLE-01 001 contig_1720 7120 169 T 156295ff5928fc055 read-2 True ATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTT
000000067 SAMPLE-01 001 contig_1720 7120 150 T 7a8947678111bb905 read-2 True TTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACA
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000097 SAMPLE-02 001 contig_1720 7111 140 G ddb72ab632d753591 read-2 True TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCA
000000098 SAMPLE-02 001 contig_1720 7111 75 G e7506ec6da1f08697 read-2 False TAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCA
000000099 SAMPLE-02 001 contig_1720 7111 65 G 07f926c7d8dd57e03 read-2 True TCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACC
000000100 SAMPLE-02 001 contig_1720 7111 54 G 97fb9b743bbe5d89a read-2 True GTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACCGGTAATGTTA
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000103 SAMPLE-02 001 contig_1720 7115 69 A 07f926c7d8dd57e03 read-2 True TCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACC
000000104 SAMPLE-02 001 contig_1720 7115 58 A 97fb9b743bbe5d89a read-2 True GTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACCGGTAATGTTA
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000105 SAMPLE-02 001 contig_1720 7120 149 T ddb72ab632d753591 read-2 True TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCA
000000106 SAMPLE-02 001 contig_1720 7120 84 T e7506ec6da1f08697 read-2 False TAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCA
000000107 SAMPLE-02 001 contig_1720 7120 74 T 07f926c7d8dd57e03 read-2 True TCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGTGCAATAATTATTATTTTTGTACC
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)
000000109 SAMPLE-03 001 contig_1720 7111 181 G 5b30beaad5028d9be read-2 False CATCATAGTAATATTGCAACTATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTT
000000110 SAMPLE-03 001 contig_1720 7111 167 G a74a16460eee34549 read-2 False TGCAACTATTGGTTTTGCTATTGGGTTTGTCGTGATGATGATGATAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTT
000000111 SAMPLE-03 001 contig_1720 7111 158 G 3ec0b8a88b8cf6f6b read-2 False TGGTTTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000112 SAMPLE-03 001 contig_1720 7111 158 G 237828c6637b1648e read-2 False TGGTTTTGCTATTGGGTTTGTCGGGATGATGATGTTAGATGTCGCCTTAGGTTAATCTGTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000113 SAMPLE-03 001 contig_1720 7111 154 G 006dfcf9742b2a323 read-2 True TTTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGATGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000114 SAMPLE-03 001 contig_1720 7111 153 G ab174bde7a9f86013 read-2 False TTGCTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAA
000000115 SAMPLE-03 001 contig_1720 7111 150 G 4fdd1e6de2a10c923 read-2 True CTATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTT
000000116 SAMPLE-03 001 contig_1720 7111 149 G cc5f916935b4b42be read-2 False TATTGGGTTTTTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAA
000000117 SAMPLE-03 001 contig_1720 7111 148 G 857199a218edef55d read-2 False ATTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACGGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTT
000000118 SAMPLE-03 001 contig_1720 7111 147 G 7f5890d7daeb66d06 read-2 False TTGGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAA
000000119 SAMPLE-03 001 contig_1720 7111 145 G e1f31dfa0435ffb78 read-2 True GGGTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAATAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTT
000000120 SAMPLE-03 001 contig_1720 7111 143 G 8204d0adc702d99ba read-2 True GTTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAA
000000121 SAMPLE-03 001 contig_1720 7111 142 G baaa46d85f2425750 read-2 False TTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTCAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAAT
000000122 SAMPLE-03 001 contig_1720 7111 142 G 571209d8eacfbec10 read-2 True TTTGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAATAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAA
000000123 SAMPLE-03 001 contig_1720 7111 140 T 3dda82d075cb90188 read-2 False TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTTGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGG
000000124 SAMPLE-03 001 contig_1720 7111 140 G 4cc7969a78d30d313 read-2 False TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTA
000000125 SAMPLE-03 001 contig_1720 7111 140 G 418eca79d0630e0fe read-2 False TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTATGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTC
000000126 SAMPLE-03 001 contig_1720 7111 140 G 6f72cff910f80d2c5 read-2 True TGTCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTT
000000127 SAMPLE-03 001 contig_1720 7111 138 G 3fd470af01ec4eb4f read-2 True TCGTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTC
000000128 SAMPLE-03 001 contig_1720 7111 136 G a533ced1530eea9a8 read-2 True GTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCA
000000129 SAMPLE-03 001 contig_1720 7111 136 G 6a9f13baa13e23d0a read-2 True GTGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCA
000000130 SAMPLE-03 001 contig_1720 7111 135 G 72d19ae35f5136c1a read-2 False TGATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTA
000000131 SAMPLE-03 001 contig_1720 7111 134 G 529c1460d824e9bef read-2 False GATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTT
000000132 SAMPLE-03 001 contig_1720 7111 134 G 69c5dbf13623487fb read-2 False GATGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATTGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTCTATCTAA
000000133 SAMPLE-03 001 contig_1720 7111 132 G fcd57363c61946297 read-2 False TGATGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTG
000000134 SAMPLE-03 001 contig_1720 7111 129 G c462177c026ee961e read-2 True TGATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTA
000000135 SAMPLE-03 001 contig_1720 7111 128 G 2295d9de5ef4cf13e read-2 False GATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGGGTTATGG
000000136 SAMPLE-03 001 contig_1720 7111 127 G 305879fc8883daf8d read-2 True ATGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAAT
000000137 SAMPLE-03 001 contig_1720 7111 126 G 5df2a0285fcc03a9e read-2 False TGTTAGATGTCGCCTTAGGTTAAGCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTATGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGG
000000138 SAMPLE-03 001 contig_1720 7111 126 G ee2961de43ccb9aa1 read-2 False TGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCATGAG
000000139 SAMPLE-03 001 contig_1720 7111 126 G 3c7c5b2afc9694223 read-2 True TGTTAGATGTCGCCTTAGGTTAATCTCTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCT
000000140 SAMPLE-03 001 contig_1720 7111 126 G 0b0eb68568f992851 read-2 True TGTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAACAACAATTTTATCTAATATGTCAGGAGTTATG
000000141 SAMPLE-03 001 contig_1720 7111 125 G 6ad74742e16c874d9 read-2 False GTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATG
000000142 SAMPLE-03 001 contig_1720 7111 125 G d8a10c29daa22874a read-2 False GTTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTA
000000143 SAMPLE-03 001 contig_1720 7111 124 G 2fcdca66158af9cc9 read-2 False TTAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATC
000000144 SAMPLE-03 001 contig_1720 7111 123 G eb182dc3869777d40 read-2 True TAGATGTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTA
000000145 SAMPLE-03 001 contig_1720 7111 118 G 07067ba83a92c090d read-2 False GTCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAG
000000146 SAMPLE-03 001 contig_1720 7111 117 G 221720449a9df5f2e read-2 False TCGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTAT
000000147 SAMPLE-03 001 contig_1720 7111 116 G 6a32ac39d688c9342 read-2 True CGCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTAT
000000148 SAMPLE-03 001 contig_1720 7111 115 G 7a35d6e5df5c0313c read-2 True GCCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGATGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTA
000000149 SAMPLE-03 001 contig_1720 7111 114 G d71843e1b8dfc97c1 read-2 False CCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGATATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATT
000000150 SAMPLE-03 001 contig_1720 7111 114 G 97810094800c2730d read-2 False CCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTT
000000151 SAMPLE-03 001 contig_1720 7111 114 G a1a82ff1ac7d6c00a read-2 True CCTTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGTAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCT
000000152 SAMPLE-03 001 contig_1720 7111 113 G e79875a99e454d374 read-2 False CTTAGGTTAATCTTTACATAATCGTAAGGACCGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTT
000000153 SAMPLE-03 001 contig_1720 7111 112 G 6b818ac19ef9992b2 read-2 False TTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTAT
000000154 SAMPLE-03 001 contig_1720 7111 112 G 33a1ab1044fbce5d2 read-2 True TTAGGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCT
000000155 SAMPLE-03 001 contig_1720 7111 109 G ed19fd79f7f532930 read-2 False GGTTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAAT
000000156 SAMPLE-03 001 contig_1720 7111 107 G 2eb280af5a55f65d2 read-2 False TTAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTT
000000157 SAMPLE-03 001 contig_1720 7111 106 G d6295261bd3682093 read-2 False TAATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAAT
000000158 SAMPLE-03 001 contig_1720 7111 106 G e1324c70548d7aac2 read-2 False TAATCTTTACATAATCTTAAGCAGAGTTGTATAGTTTCGTTTCTGTAGTTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAAT
000000159 SAMPLE-03 001 contig_1720 7111 106 G e0ec923db2ffe9978 read-2 True TAATCTTTACATAATCTTAAGCACAGTTGTATAGCTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGG
000000160 SAMPLE-03 001 contig_1720 7111 104 G 7cc251d99ddec1738 read-2 False ATCTTTACATAATCTTAAGCACAGTTGTATAGTTTCGTTTCTGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAAT
000000161 SAMPLE-03 001 contig_1720 7111 100 G 18f3cf83405581ea6 read-2 False TTACATAATCGTAAGCACAGTTGTATAGTTTCGTTTCAGTAATTAAGTAAAATGAGGTTAAAGAGGTGACAGAAATGAAAAAGAGATTAGGGTTAGGTTTGGGAATGTTTTTAATAACAATTTTATCTAATTTGTCAGGAGTTATGGCTTATAGTGGTAATAGTAATTTACCGGGAAGT
(…) (…) (…) (…) (…) (…) (…) (…) (…) (…) (…)

Where

  • sample_id matches to the input BAM file name,

  • request_id matches to the order of the contig name in the input file,

  • pos_in_contig marks the position of interest declared in the input file,

  • and pos_in_read marks the actual location of the nucleotide in the short reads that corresponds to the position of interest.

Edit this file to update this information.